ID: 1034522498_1034522507

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1034522498 1034522507
Species Human (GRCh38) Human (GRCh38)
Location 7:151631931-151631953 7:151631949-151631971
Sequence CCCGGCCCCTGGGCTTCCGCAGG GCAGGACGCAGCTCGCCGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 420} {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!