ID: 1034524447_1034524457

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1034524447 1034524457
Species Human (GRCh38) Human (GRCh38)
Location 7:151648362-151648384 7:151648407-151648429
Sequence CCTTGTACCGCCTGAAAGCATCT GCCCCCTGCTTTGGGAAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 78} {0: 1, 1: 0, 2: 3, 3: 10, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!