ID: 1034524453_1034524457

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1034524453 1034524457
Species Human (GRCh38) Human (GRCh38)
Location 7:151648394-151648416 7:151648407-151648429
Sequence CCGTGGTCCTCATGCCCCCTGCT GCCCCCTGCTTTGGGAAAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 403} {0: 1, 1: 0, 2: 3, 3: 10, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!