ID: 1034539262_1034539276

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1034539262 1034539276
Species Human (GRCh38) Human (GRCh38)
Location 7:151745778-151745800 7:151745816-151745838
Sequence CCCTGGATCTCCTTAAAATCTGG CCCCCATGGAGGGCTCGGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 13, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!