ID: 1034544283_1034544286

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1034544283 1034544286
Species Human (GRCh38) Human (GRCh38)
Location 7:151779660-151779682 7:151779673-151779695
Sequence CCTGCTTGCCTCTGACTAGGAGC GACTAGGAGCCCTTGAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 120} {0: 1, 1: 1, 2: 3, 3: 20, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!