ID: 1034581142_1034581146 |
View in Genome Browser |
Spacer: 11 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1034581142 | 1034581146 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:152043606-152043628 | 7:152043640-152043662 |
| Sequence | CCTGCCTGAATAGAACTGAGAGC | GTGCAGCTTGAACAGTCAGTGGG |
| Strand | - | + |
| Off-target summary | {0: 21, 1: 88, 2: 58, 3: 27, 4: 123} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||