ID: 1034589738_1034589742

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1034589738 1034589742
Species Human (GRCh38) Human (GRCh38)
Location 7:152129070-152129092 7:152129094-152129116
Sequence CCTGGCGGCGGGGGAGCTGCGGA GCCGCGGAGTCCGATGTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 269} {0: 1, 1: 0, 2: 0, 3: 5, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!