ID: 1034618174_1034618188

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1034618174 1034618188
Species Human (GRCh38) Human (GRCh38)
Location 7:152436260-152436282 7:152436312-152436334
Sequence CCGCGCGTCAGGCCCGTCAGGCC GCTGCTCCAGTGGCGGCGCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!