ID: 1034622063_1034622074

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1034622063 1034622074
Species Human (GRCh38) Human (GRCh38)
Location 7:152464018-152464040 7:152464034-152464056
Sequence CCTCCCCCCGAGAGGAGGGAGAC GGGAGACCCGGAAGGCGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 158} {0: 1, 1: 0, 2: 1, 3: 22, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!