ID: 1034630135_1034630144

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1034630135 1034630144
Species Human (GRCh38) Human (GRCh38)
Location 7:152524286-152524308 7:152524335-152524357
Sequence CCAGGAGGTGATCGGTCACATTC GCTTTCATGGCAGGGGACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 78} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!