ID: 1034645832_1034645836

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1034645832 1034645836
Species Human (GRCh38) Human (GRCh38)
Location 7:152646455-152646477 7:152646500-152646522
Sequence CCCTGGCAAAGGTATGATCTTGT TTTTAGAGATGGAGTCGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 247} {0: 1, 1: 14, 2: 136, 3: 258, 4: 716}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!