|
Left Crispr |
Right Crispr |
Crispr ID |
1034645834 |
1034645836 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
7:152646479-152646501
|
7:152646500-152646522
|
Sequence |
CCTTATATTTTATTTTTTATTTT |
TTTTAGAGATGGAGTCGCCCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 30, 2: 251, 3: 2827, 4: 47980} |
{0: 1, 1: 14, 2: 136, 3: 258, 4: 716} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|