ID: 1034647899_1034647910

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1034647899 1034647910
Species Human (GRCh38) Human (GRCh38)
Location 7:152664761-152664783 7:152664803-152664825
Sequence CCCCAAGGAATGTCCAGGTGGCC GTTGCAGCTGGCACCAGGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 8, 3: 33, 4: 315}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!