ID: 1034688396_1034688400

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1034688396 1034688400
Species Human (GRCh38) Human (GRCh38)
Location 7:152994460-152994482 7:152994493-152994515
Sequence CCAAGGCTGTCCAAGGAGCAGCT GCTTCCTGGTTAGAAGGAACAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 3, 3: 23, 4: 235} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!