ID: 1034692427_1034692441

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1034692427 1034692441
Species Human (GRCh38) Human (GRCh38)
Location 7:153024442-153024464 7:153024491-153024513
Sequence CCCTCTCCTCTCTCTCTCTCACC CCAGCTACAAGGGTGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 119, 3: 859, 4: 5137} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!