ID: 1034734239_1034734247

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1034734239 1034734247
Species Human (GRCh38) Human (GRCh38)
Location 7:153413657-153413679 7:153413701-153413723
Sequence CCTGGCAGCAAGTAACCGGACGA GAGAAGCCTGACCTGACTGAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 2, 3: 3, 4: 22} {0: 5, 1: 0, 2: 1, 3: 24, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!