ID: 1034781894_1034781910

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1034781894 1034781910
Species Human (GRCh38) Human (GRCh38)
Location 7:153888336-153888358 7:153888380-153888402
Sequence CCCCCAGGAGGGCCGCGTGCCTG AGGCTCCGGGCAGCTGGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 163} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!