ID: 1034796852_1034796859

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1034796852 1034796859
Species Human (GRCh38) Human (GRCh38)
Location 7:154021572-154021594 7:154021592-154021614
Sequence CCAAACGAGGGCCAGTTATCCCC CCCTGTGTATGTGGGGCTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 26, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!