ID: 1034823423_1034823430

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1034823423 1034823430
Species Human (GRCh38) Human (GRCh38)
Location 7:154237807-154237829 7:154237854-154237876
Sequence CCTCAGTACATCTTGAAATAATA TCCCTGCTGAGGGGAGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 337} {0: 1, 1: 1, 2: 3, 3: 37, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!