ID: 1034842145_1034842157

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1034842145 1034842157
Species Human (GRCh38) Human (GRCh38)
Location 7:154408833-154408855 7:154408878-154408900
Sequence CCCCCCAACTCAAATTTATATGT TGCCTGTAATCCCAGCACTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 56, 4: 383} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!