ID: 1034844271_1034844279

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1034844271 1034844279
Species Human (GRCh38) Human (GRCh38)
Location 7:154430024-154430046 7:154430054-154430076
Sequence CCATCCACCCTCCCAGTTCTCAG AGGTGAGAAGCTCCTCTTCTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 58, 4: 1991}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!