ID: 1034879512_1034879514

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1034879512 1034879514
Species Human (GRCh38) Human (GRCh38)
Location 7:154752676-154752698 7:154752691-154752713
Sequence CCACCGCAGGAGGCTGTAGCTCT GTAGCTCTGACGTGCCCAAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 5, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!