ID: 1034885135_1034885144

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1034885135 1034885144
Species Human (GRCh38) Human (GRCh38)
Location 7:154793521-154793543 7:154793555-154793577
Sequence CCAATTTCCCTAATTAGCTAGAG GTATTTTATCTTTAAGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 143} {0: 1, 1: 0, 2: 2, 3: 20, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!