ID: 1034885268_1034885285

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1034885268 1034885285
Species Human (GRCh38) Human (GRCh38)
Location 7:154794163-154794185 7:154794202-154794224
Sequence CCTCACCCTCTGCGACGCCACCA GGTACGCGGGGCTGTGGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 168} {0: 1, 1: 0, 2: 2, 3: 37, 4: 429}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!