ID: 1034885454_1034885458

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1034885454 1034885458
Species Human (GRCh38) Human (GRCh38)
Location 7:154795054-154795076 7:154795075-154795097
Sequence CCTGGGGCGGATTCCAGGCTATT TTCTGATGAGCTTGCTTGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 16, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!