ID: 1034885454_1034885461

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1034885454 1034885461
Species Human (GRCh38) Human (GRCh38)
Location 7:154795054-154795076 7:154795092-154795114
Sequence CCTGGGGCGGATTCCAGGCTATT GAGGGGAAGGAAGGAACGTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 15, 3: 167, 4: 1564}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!