ID: 1034885455_1034885461

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1034885455 1034885461
Species Human (GRCh38) Human (GRCh38)
Location 7:154795067-154795089 7:154795092-154795114
Sequence CCAGGCTATTCTGATGAGCTTGC GAGGGGAAGGAAGGAACGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 116} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!