ID: 1034889796_1034889810

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1034889796 1034889810
Species Human (GRCh38) Human (GRCh38)
Location 7:154829785-154829807 7:154829837-154829859
Sequence CCTCCATCCTGCTCAAAGCCCTC CTGCTCCTCATGTGGAATCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 63, 4: 702} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!