ID: 1034889801_1034889808

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1034889801 1034889808
Species Human (GRCh38) Human (GRCh38)
Location 7:154829807-154829829 7:154829829-154829851
Sequence CCCACCCTTCACCACCACCAAAC CACCATCTCTGCTCCTCATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 567} {0: 1, 1: 0, 2: 5, 3: 21, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!