ID: 1034889805_1034889810

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1034889805 1034889810
Species Human (GRCh38) Human (GRCh38)
Location 7:154829818-154829840 7:154829837-154829859
Sequence CCACCACCAAACACCATCTCTGC CTGCTCCTCATGTGGAATCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 93, 4: 801} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!