ID: 1034890934_1034890940

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1034890934 1034890940
Species Human (GRCh38) Human (GRCh38)
Location 7:154838665-154838687 7:154838696-154838718
Sequence CCTAAGGACGCACGTGCAAGACC GGAGGCTTTGTGTGTGCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!