ID: 1034901492_1034901495

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1034901492 1034901495
Species Human (GRCh38) Human (GRCh38)
Location 7:154910467-154910489 7:154910480-154910502
Sequence CCATCTCCAGCCTGTGCACCATC GTGCACCATCCCTGCAGCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 100, 4: 1558}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!