ID: 1034946624_1034946639

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1034946624 1034946639
Species Human (GRCh38) Human (GRCh38)
Location 7:155266640-155266662 7:155266693-155266715
Sequence CCGGCATCCATGGGCTTCCCTAT CAGAAGCTGGGAGGGGCAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 22, 3: 264, 4: 1638}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!