ID: 1034948988_1034948999

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1034948988 1034948999
Species Human (GRCh38) Human (GRCh38)
Location 7:155284468-155284490 7:155284507-155284529
Sequence CCACCTGCCTCAGCCTCCCAAAG ATGAGCCACCTCGCCTGGATGGG
Strand - +
Off-target summary {0: 25296, 1: 77323, 2: 157079, 3: 168016, 4: 148902} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!