ID: 1034952055_1034952058

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1034952055 1034952058
Species Human (GRCh38) Human (GRCh38)
Location 7:155305245-155305267 7:155305270-155305292
Sequence CCGCCTACCACTGTTTTTATTCA AATACTTAAATCCTTACCTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 27, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!