ID: 1034952056_1034952058

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1034952056 1034952058
Species Human (GRCh38) Human (GRCh38)
Location 7:155305248-155305270 7:155305270-155305292
Sequence CCTACCACTGTTTTTATTCATAA AATACTTAAATCCTTACCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 387} {0: 1, 1: 0, 2: 1, 3: 27, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!