ID: 1034964858_1034964869

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1034964858 1034964869
Species Human (GRCh38) Human (GRCh38)
Location 7:155384626-155384648 7:155384663-155384685
Sequence CCCGCCCTGAACCAGAATCCAGG CAGCACAGCAGCACCAACGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 236} {0: 1, 1: 0, 2: 1, 3: 19, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!