ID: 1034967487_1034967490

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1034967487 1034967490
Species Human (GRCh38) Human (GRCh38)
Location 7:155400194-155400216 7:155400217-155400239
Sequence CCTGGGTGACTGAGGGGCAACAG CCCCACATCCGTGCTGCAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 22, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!