ID: 1034969625_1034969631 |
View in Genome Browser |
Spacer: 25 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1034969625 | 1034969631 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:155410943-155410965 | 7:155410991-155411013 |
| Sequence | CCTTCCTCCATCTTCACAGGCAG | TTCCTAGTCACACCTGCCCCTGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 18, 2: 229, 3: 581, 4: 1160} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||