ID: 1034978014_1034978032

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1034978014 1034978032
Species Human (GRCh38) Human (GRCh38)
Location 7:155459069-155459091 7:155459109-155459131
Sequence CCGCGGGGACCACGCGTCCCGGC GCGGAGCTGGGGGGCGGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116} {0: 1, 1: 0, 2: 6, 3: 83, 4: 834}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!