ID: 1034978014_1034978033

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1034978014 1034978033
Species Human (GRCh38) Human (GRCh38)
Location 7:155459069-155459091 7:155459114-155459136
Sequence CCGCGGGGACCACGCGTCCCGGC GCTGGGGGGCGGTGCTGGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116} {0: 1, 1: 0, 2: 5, 3: 52, 4: 642}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!