ID: 1034983607_1034983616

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1034983607 1034983616
Species Human (GRCh38) Human (GRCh38)
Location 7:155494224-155494246 7:155494256-155494278
Sequence CCCCACCAAATCCGAGTGAGGAG CTGGATCTCCGTCAGAGCCGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!