ID: 1034993401_1034993408

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1034993401 1034993408
Species Human (GRCh38) Human (GRCh38)
Location 7:155562289-155562311 7:155562311-155562333
Sequence CCCGGGTGGAGCTGGACTTCAGG GGGAGGAGGTGACGTCCACGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!