ID: 1035018734_1035018741

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1035018734 1035018741
Species Human (GRCh38) Human (GRCh38)
Location 7:155788098-155788120 7:155788145-155788167
Sequence CCGTGGGAGCCGCGAGTGTCTGG CAATGTATTCAGGTTTCCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 11, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!