ID: 1035022021_1035022037

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1035022021 1035022037
Species Human (GRCh38) Human (GRCh38)
Location 7:155805771-155805793 7:155805816-155805838
Sequence CCCTGGGTTTACTGCCGCCCACC TAGGATCCACGGGCGCCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 97} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!