ID: 1035067842_1035067850

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1035067842 1035067850
Species Human (GRCh38) Human (GRCh38)
Location 7:156121248-156121270 7:156121281-156121303
Sequence CCCCATCCTGCAGGAAGCCCTCA GTGAAAGCCATGCCAAGGAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 20, 3: 163, 4: 773} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!