ID: 1035113130_1035113133

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1035113130 1035113133
Species Human (GRCh38) Human (GRCh38)
Location 7:156501136-156501158 7:156501154-156501176
Sequence CCCCATTGCTTATTTTGTCAGGT CAGGTTTGTCAAAGATCAGATGG
Strand - +
Off-target summary No data {0: 5728, 1: 3902, 2: 2458, 3: 1806, 4: 2520}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!