ID: 1035115937_1035115943

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1035115937 1035115943
Species Human (GRCh38) Human (GRCh38)
Location 7:156523978-156524000 7:156524006-156524028
Sequence CCTCCCTTGGTGGAAGGTGTCTA TCACACTCCCAAGCCCAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 174} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!