ID: 1035133255_1035133266

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1035133255 1035133266
Species Human (GRCh38) Human (GRCh38)
Location 7:156675306-156675328 7:156675345-156675367
Sequence CCGTCTTTGGAGACGAGGGTGCC TGTGACCCACTTTAGGGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 126} {0: 1, 1: 0, 2: 0, 3: 18, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!