|
Left Crispr |
Right Crispr |
| Crispr ID |
1035163819 |
1035163823 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:156971548-156971570
|
7:156971584-156971606
|
| Sequence |
CCGTATGTTATACAGGCTGGCCT |
TACCTTGGCCTCCCAAACACCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 35, 3: 708, 4: 4492} |
{0: 1, 1: 2, 2: 28, 3: 318, 4: 1638} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|